New Noroviruses

picture2
New antigenically distinct norovirus variants emerged periodically. They may lead to atypical surge in norovirus-associated acute gastroenteritis outbreaks and infections in the community. We believe timely sharing of sequence data will help molecular surveillance and foster collaborations among labs from different countries. With this in mind, we post nucleotide sequences of emerging norovirus genotypes and variants. These strains were all collected from hospitalized gastroenteritis patients in our norovirus surveillance in Hong Kong.
[31 Mar 2017] GII.2 – Our complete genome of the emergent recombinant norovirus GII.P16-GII.2 is now available on GenBank under accession number KY771081.
Please cite: Chan MC et al. Complete genome sequence of an emergent recombinant GII.P16-GII.2 norovirus strain associated with an epidemic spread in the winter of 2016-2017 in Hong Kong, China. Genome Announc. 2017 May;5(20):e00343-17. [Publisher | Free]
[16 Mar 2017] GII.2 – We have determined a complete genome of the emergent recombinant norovirus GII.P16-GII.2 using metagenomic next-generation sequencing on MiSeq platform. The sequence was collected from a case in September 2016, Hong Kong and has been deposited into GenBank under accession number KY771081. We will make the sequence publicly available shortly. Sequencing protocols are available upon request
>KY771081_GII/Hu/HK/2016/GII.P16-GII.2/CUHK-NS-1082
GTGAATGAAGATGGCGTCGAATGACGCTACCGTTGCCGTTGCTTGCAACAACAACAACGACAAAGAAAAATCTTCAGGTGAAGGCTTATTCACAAATATGTCTTCCACCTTAAAGAAAGCCCTCGGGGCTAGGCCCAAACAGCCTGCCCCGAGAGACAAACCACAAAAGCCCCCAAGACCACCAACTCCCGAGTTGGTCAAGAGGATACCCCCTCCTCCACCTAATGGCGAAGAAGAAGAAGAACCAGTCATTAGGTATGAGGTTAAGAGTGGGATCTCTGGCCTGCCCGAGCTCACAACAGTCCCCCAACCGGACGTGGCCAACACAGCATTTAGTGTTCCACCACTGAGCTTGAGAGAAAACAGGGAGGCCAAGGAACCGCTAACAGGGGCAATATTAGAGATGTGGGATGGAGAGATATACCACTATGGCCTGTACGTGGAGAAAGGCTTAGTGTTGGGTGTGCACAAACCACCTGCAGCCATAAGCATGGCAAGAGTGGAGCTGACGCCGCTGTCATTGTACTGGCGTGTGGTGTACACCCCCCAATACCTCATCTCCCCTGAATCTCTCAGGAGGCTCAACGGAGAGGCATTCCCTTACACCGCCTTTGACAACAACTGCTATGCCTTTTGCTGCTGGGTGTTAGACCTTAATGACTCATGGCTTAGCAGGAGGATGGTACAAAGAACAACGGGCTTCTTTAGACCTTACCAAGAGTGGAACAGAAAACCCCTGCCTACCATGGATGACTCCAAAATTAAGAAGGTAGCAAATATATTCCTATGTTCATTGTCCACATTATTCACCAGACCCATAAAAGACCTCATAGGAAAAATTAAACCATTAAACATATTGAATATCCTGGCAACGATTGACTGGACTTTTGCCGGAATAGTGGAGTCTCTGATATTACTTGCTGAACTCTTTGGAGTTTTCTGGACACCCCCAGATGTGTCTGCTATGATCGCTCCCTTACTCGGGGACTACGAGTTGCAAGGGCCAGAAGACCTCGCCGTTGAACTCGTACCTGTGGTGATGGGGGGGATTGGCTTGGTGTTGGGATTCACCAAAGAGAAAATTGGCAAAATGTTGTCCTCAGCAGCATCAACACTCAGGGCTTGCAAAGATCTTGGTGCCTATGGCTTAGAGATACTCAAATTGGTCATGAAGTGGTTCTTCCCAAAGAAAGAGGAGGCCAATGAGCTAGCCATGGTGAGAGCCATAGAGGATGCTGTACTAGATCTTGAGGCAATAGAAAATAACCACATGACAACCCTGTTGAAAGACAAAGACAGCTTAGCAACATACATGAAAACATTGGACATGGAGGAGGAGAAAGCCAGGAGGTTGTCCACAAAATCTGCATCCCCTGACATAGTTGGGACAATCAACGCCCTGCTGGCTCGAATAGCAGCGGCCAGGTCGTTAGTCCACAGGGCCAAGGAAGAGCTATCTAGCAGGATAAGACCAGTAGTTGTTATGATATCTGGCAAACCAGGAATAGGCAAAACTCATCTGGCCAGGGAGGTGGCAAGAAAGGTGGCATCCACTCTCACAGGGGATCAAAGAGTCGGACTCATACCACGAAACGGTGTGGACCATTGGGATGCATACAAAGGTGAGAGAGTCGTGCTGTGGGACGACTATGGCATGAGTAACCCCATTCATGATGCTCTTCGCATACAAGAATTGGCTGATACGTGTCCCCTTACCTTAAATTGTGACAGAATTGAAAATAAGGGAAAAGTTTTTGACAGTGAAGTCATAATAATTACAACAAACCTTGCCAATCCAGCCCCACTTGATTATGTCAACTTTGAGGCCTGTTCCAGGAGAATTGATTTCCTGGTGTACGCTGAGGCACCAGAAGTAGAAAAGGCAAAACGGGACTTTCCTGGTCAGCCAGATATGTGGAAGGACGCCTTCAAGCCGGACTTTTCACACATCAAGCTACAGCTTGCACCCCAGGGCGGCTTTGACAAGAATGGCAACACCCCACATGGGAAAGGAGTGATGAAGACCCTCACTACCGGTTCTCTGATTGCCCGTGCATCAGGCCTACTGCATGAGAGGATGGATGAATTTGAACTCCAAGGTCCCACAACCACCACCTTCAATTTCGACCGGAACAGAATCACAGCATTCAGACAATTGGCTGCAGAAAACAAGTATGGATTGGTGGATACCATGAAAGTTGGCAATCAATTAAAAGGAGTGAAAACCATGGAAGAACTCAAACAAGCAATCAGGAATGTGACCATCAAGAGGTGCCAGATCATCTACGGTGGTTCCACGTATGACCTTGAATCTGATGGCAAGGGCAAAGTTTTGGTGGAAAAGGTCAAGAACACCTCTGTACAGACCAACAACGAGTTGGCTGGGGCCCTGCACCATCTCAAACATGCCCGAATCAGGTACTATGTCAAATGTGTGCAAGAAGCAGTCTATTCCATCATACAAATTGCCGGCGCTGCGTTTGTCACCACGCGCATTGCACGCCGCATGAACATACAAGAACTCTGGTCGAAGCCACAATTAGATCAAAATGAATCAGAGACTAAGGAAGAGGCCCCCAAGTCAGAAGATGACGAGTTCATCATATCTTCTAAAGACATCAAGGAGGAAGGAAAGAAGGGCAAAAACAAAACTGGCCGTGGCAAGAAACACACTGCATTCTCCAGCAAGGGCTTGAGCGATGAGGAGTATGACGAGTACAAGAGGATAAGAGAAGAGAGAAATGGGAAGTACTCTATAGAGGAGTATCTTCAAGACAGAGACAGGTACTATGAGGAGCTCGCCATTGCCAAGGCCACGGAAGAAGACTTCTGTGAAGAGGAGGAGATCAAAATCCGTCAGAGAATTTTCCGTCCCACCAGGAAACAAAGAAAGGAAGAGAGGGCTACATTAGGGCTAGTAACAGGTTCAGAAATCAGAAAAAGAAACCCTGATGACTTCAAACCCAAAGGGAAGCTGTGGGCCGATGACAACAGGAGTGTTGACTACAATGAGAAACTGGACTTTGAGGCCCCCCCAAGCATATGGTCTAGGATTGTGAGCTTTGGTTCTGGCTGGGGCTTCTGGGTGTCACCAAGCCTTTTCATAACATCAACTCATGTAATCCCCGCAGGCATAACAGAGGCATTTGGAGTCCCCATCAAACAAATTCAGATCCACAAATCAGGTGAATTTTGCCGATTCAGATTCCCAAAACCAATTAGACCAGATGTGACAGGAATGATCTTGGAAGAAGGTGCGCCTGAGGGCACCGTGGCAACTGTGCTCATCAAACGCCCCACCGGAGAGCTCATGCCTCTTGCAGCCAGAATGGGAACACACGCAACCATGAAAATTCAAGGCCGCATGGTTGGCGGACAGATGGGTATGTTGCTCACTGGATCAAATGCTAAAGGAATGGACTTGGGAACAACTCCTGGTGACTGTGGCTGTCCTTACATCTATAAAAGGGGCAATGACTATATAGTCATTGGGGTGCACACTGCAGCAGCCCGTGGTGGAAACACCGTCATCTGTGCCACACAGGGAAGTGAGGGTGAGGCAACTCTTGAGGGTGGAGATGACAAAGGAACATACTGTGGGGCACCCATTCTAGGCCCTGGAGGTGCACCAAAATTGAGCACCAAAACCAAATTTTGGAGATCATCGAACACGCCCCTTCCACCAGGGACATATGAGCCTGCCTACCTCGGTGGCCGTGATCCGCGTGTTAAGGGTGGGCCTTCCCTGCAGCAGGTAATGAGAGACCAGTTGAAGCCATTCACTGAACCCAGGGGCAAACCTCCAAGACCAAGTGTATTGGAAGCAGCCAAACAAACCATCATCAATGTCCTCGAACAAACCCTGGACCCTCCACAAAAATGGACATACGCACAGGCGTGTGCCTCACTTGACAAAACCACCTCCAGCGGGCATCCCCATCACGTCCGAAAGAATGAATTCTGGAATGGTGAGACCTTCACTGGTAAACTGGCAGACCAAGCATCAAAAGCAAACCTAATGTTTGAGGAAGGGAAACACATGACACCAGTGTACACAGCAGCACTCAAGGACGAGCTAGTCAAGACTGAGAAAATCTATGGAAAGATCAAGAAGAGACTGCTCTGGGGCTCTGACTTGTCCACCATGATCCGGTGCGCTAGGTCATTTGGTGGGCTCATGGACGAGATGAAGGCACACTGCGTATCACTCCCAGTCCGAGTTGGCATGAATATGAATGAAGATGGCCCAATAATATTTGAGAAACATTCCAGATACAAATATCACTATGATGCAGACTACTCTCGTTGGGATTCGACACAACAGAGGGCAGTACTAGCAGCAGCCTTGGAAATCATGGTCAGATTCTCTGCAGAACCACAATTGGCACAAATAGTTGCTGAGGATCTGCTGGCCCCTAGTGTAGTAGATGTAGGAGACTTTAAAATTACAATAAATGAAGGGCTCCCTTCTGGTGTGCCATGCACTTCTCAATGGAACTCCATCGCACACTGGCTGCTAACTCTCTGTGCCTTGTCTGAAGTCACCAAACTGTCCCCTGACATTATACAGGCAAATTCCATGTTCTCATTTTACGGTGATGACGAGATTGTCAGCACCGACATAAAATTGGACCCTGAACAATTAACCGCCAAATTGAAGGAGTACGGCCTGAAACCAACCCGCCCAGACAAAACCGAGGGACCCCTGATTATCAGTGAAGATTTGAACGGTCTCACTTTCCTCCGAAGGACGGTGACTCGTGACCCAGCTGGCTGGTTTGGAAAACTGGACCAAAGCTCAATTTTGAGGCAGATGTACTGGACTAGAGGACCAAATCATGAAGACCCCAATGAGACAATGATACCCCATTCTCAAAGACCCATACAGCTCATGGCACTGCTTGGTGAAGCCTCTCTTCACGGACCCTTTTTCTACAGTAAAATCAGTAAATTGGTCATAACTGAACTCAAAGAAGGTGGGATGGACTTTTACGTGCCAAGGCAGGAACCCATGTTCAGGTGGATGAGGTTTTCTGACTTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAATTTTGTGAATGAAGATGGCGTCGAATGACGCCGCTCCATCTACTGATGGTGCAGCCGGCCTCGTGCCAGAAAGTAACAATGAGGTCATGGCTCTTGAACCCGTGGCTGGTGCCGCCTTGGCAGCCCCGGTCACCGGTCAAACAAATATTATAGACCCTTGGATTAGAGCAAATTTTGTCCAGGCCCCCAATGGTGAATTTACAGTCTCTCCCCGAAATGCCCCTGGTGAAGTGCTATTGAATCTAGAGTTGGGTCCAGAATTAAATCCTTATCTGGCACATTTAGCAAGAATGTACAATGGGTATGCCGGTGGGATGGAGGTGCAGGTCATGTTGGCTGGGAACGCGTTCACAGCCGGCAAGTTGGTCTTCGCCGCCGTGCCTCCTCACTTCCCGGTTGAAAACCTTAGCCCACAGCAAATCACCATGTTCCCTCATGTGATCATAGATGTGAGAACCTTGGAACCTGTTTTATTACCACTCCCTGATGTTAGGAATAATTTCTTCCATTATAATCAGAAAGATGATCCCAAGATGAGGATTGTGGCTATGCTTTATACCCCCCTCAGGTCTAATGGTTCAGGTGATGATGTGTTTACAGTCTCCTGTAGAGTGTTGACTAGACCTTCCCCTGACTTTGACTTCACGTACCTGGTGCCACCAACAGTGGAGTCTAAAACAAAGCCATTCACCCTCCCAATCCTCACACTTGGGGAACTATCCAATTCTAGGTTCCCAGTGTCCATAGACCAGATGTACACCAGCCCTAATGAAGTTATATCAGTGCAGTGTCAAAATGGTAGGTGCACACTGGACGGGGAGCTCCAAGGGACAACACAACTCCAAGTCAGTGGCATTTGTGCTTTCAAAGGTGAAGTGACCGCCCACTTGCATGACAATGATCACCTATATAATGTTACCATCACAAACTTGAATGGGTCCCCTTTTGATCCCTCCGAGGACATCCCTGCCCCTCTGGGTGTGCCTGACTTCCAGGGAAGGGTTTTTGGTATCATCTCTCAAAGAGACAAACACAATAGTCCTGGTCATAATGAACCAGCAAACAGGGGACACGACGCCGTGGTCCCTACTTACACAGCACAGTACACTCCAAAACTGGGACAAATTCAAATTGGCACATGGCAGACTGACGACCTTACAGTCAACCAACCAGTCAAATTCACCCCAGTTGGACTCAATGACACTGAACATTTTAATCAATGGGTGGTCCCTAGGTATGCTGGTGCCCTAAACCTCAATACAAACCTTGCCCCTTCTGTTGCTCCAGTGTTTCCAGGAGAGCGCCTGCTCTTCTTCAGATCATACATTCCCCTCAAAGGCGGTTATGGAAACCCAGCCATTGATTGCCTACTACCACAAGAGTGGGTGCAACACTTCTATCAGGAAGCAGCCCCTTCAATGAGTGAGGTGGCCCTCGTCAGATACATCAACCCGGACACTGGTCGGGCACTGTTTGAGGCCAAGCTCCACAGAGCTGGTTTCATGACAGTCTCGAGCAACACCAGTGCCCCGGTGGTTGTGCCTGCCAACGGATACTTCAGATTTGATTCTTGGGTGAACCAATTCTATTCTCTCGCCCCCATGGGAACTGGGAATGGGCGTAGAAGGGTTCAATAATGGCTGGAGCTTTTGTAGCTGGTCTTGCAGGGGACGTGCTCAGCAATGGGCTTAGTTCATTAATCAATGCAGGTGCTAATGCAATAAATCAGAGGGCAGAATTTGATTTTAATCAGAAATTGCAGCAAAATTCTTTTAATCATGATAAGGAGATGTTGCAGGCTCAGATTCAGGCAACTAAGCAGCTGCAGGCAGACATGATGGCTATAAAGCAAGGGGTCTTGACCGCTGGCGGCTTTTCCCCTGCTGATGCAGCCAGAGGTGCTGTGAACGCGCCCATGACACAGGCGCTGGATTGGAATGGCACAAGGTATTGGGCACCAAACTCCATGAGGACCACATCTTATTCTGGAAAATTCACATCAACCGCCCCAGTGAGGCAGGCTGACTTCCAGCACACCCAAAACCGGCCTTCGAGTGGCTCCTCTGTGTCTTCCTTCGCCACTCAGTCTTCAAGGCCAACTCTGACCACAACCACTGGTTCCTCACATGGCACAGCCTCATCAAATTCAACTCGCAGCACAAGCCTCTCCCAGTCAACGGTCTCCAGAGCTACATCTAGGACTGGTGAGTGGGTTAGAGATCAAAATAGAAATTTGGAACCCTACATGCATGGTGCCTTACAGACAGCCTTTGTCACCCCACCTTCCAGCAGGGCATCTGACGGGACAGTCTCAACCGTCCCGAAAGGTGTTTTGGACTCCTGGACACCTGCGTTTAACACCCGCAGGCAGCCGCTTCTTGCACACGTCCGTAAGAGGGGGGAGTCACAAGCTTAGTGAAAAGGTGAAAATTTATTTAGGATGAATTGATTTTACCTTTTAAAAAAAAAA
[2 Feb 2017] GII.2 – Our norovirus GII.2 strain Hu/GII.2/CUHK-NS-1231/HKG/2016 is now available on GenBank under KY421044.
[27 Jan 2017] GII.2 – Report of emergent GII.P16_GII.2 linked to high norovirus activity in the winter of 2016/17 in Germany. For details, see Niendorf et al. Eurosurveillance 2017.
[21 Jan 2017] GII.2 – We sequenced complete VP1 gene of 11 GII.2 strains collected from Hong Kong during 2014-2016. Phylogenetic analysis shows that recent GII.2 strains have evolved into a distinct genetic cluster. However, these genetic changes are mostly synonymous and we do not observe any substantial changes in the major capsid protein when compared with earlier strains such as Vaals87/NL/2005. A tree with similar topology that used GII.2 strains from Japan in the winter of 2016/17 is available at Japan NIID’s IASR here: figure and full text. Full genome sequencing is needed to inspect whether or not genetic recombination with other non-structural proteins or other factors drive the recent elevated activity of GII.2 in a way similar to a previous GII.2 epidemic in Japan during 2012-2014 (Motomura et al.).

picture1

[05 Jan 2017] GII.2 – There are reports of increasing circulation of strains belonging to genotype GII.2 in part of Asia, including Japan and Taiwan in the winter of 2016/17. We also noted an increasing circulation of GII.2 starting from September 2016 but its level remained much lower than that of GII.4 Sydney 2012. Below is one representative complete VP1 sequence of a GII.2 strain collected on 19 November 2016 in Hong Kong. The VP1 has 96.2% nucleotide identity to the nearest Hu/GII.2/Vaals87/2005/NL strain on GenBank and 100% identity on protein level. RdRp genotype is also GII.P16 as in earlier GII.2 strains that had circulated in the past few years. It seems that VP1 and RdRp alone may not explain the sudden increase in circulation of GII.2 strains in Asia. The sequence has been submitted to GenBank under accession number KY421044 and will be released as soon as possible.
>KY421044_Hu/GII.2/CUHK-NS-1231/HKG/2016
ATGAAGATGGCGTCGAATGACGCCGCTCCATCTACTGATGGTGCAGCCGGCCTCGTGCCAGAAAGTAACAATGAGGTCATGGCTCTTGAACCCGTGGCTGGTGCCGCCTTGGCAGCCCCGGTCACCGGTCAAACAAATATTATAGACCCTTGGATTAGAGCAAATTTTGTCCAGGCCCCCAATGGTGAATTTACAGTCTCTCCCCGAAATGCCCCTGGTGAAGTGCTATTGAATCTAGAGTTGGGTCCAGAATTAAATCCTTATCTGGCACATTTAGCAAGAATGTACAATGGGTATGCCGGTGGGATGGAGGTGCAGGTCATGTTGGCTGGGAACGCGTTCACAGCCGGCAAGTTGGTCTTCGCCGCCGTGCCTCCTCACTTCCCGGTTGAAAACCTTAGCCCACAGCAAATCACTATGTTCCCTCATGTGATCATAGATGTGAGAACCTTGGAACCTGTTTTATTACCACTCCCTGATGTTAGGAATAATTTCTTCCATTATAATCAGAAAGATGATCCCAAGATGAGGATTGTGGCTATGCTTTATACCCCCCTCAGGTCTAATGGTTCAGGTGATGATGTGTTTACAGTCTCCTGTAGAGTGTTGACTAGACCTTCCCCTGACTTTGACTTCACATACCTGGTGCCACCAACAGTGGAGTCTAAAACAAAGCCATTCACCCTCCCAATCCTCACACTTGGGGAACTATCCAATTCTAGGTTCCCAGTGTCCATAGACCAGATGTACACCAGTCCTAATGAAGTTATATCAGTGCAGTGTCAAAATGGTAGGTGCACACTGGACGGGGAGCTCCAAGGGACAACACAACTCCAAGTCAGTGGCATTTGTGCTTTCAAAGGTGAAGTGACCGCCCACTTGCATGACAATGATCACCTATATAATGTTACCATCACAAACTTGAATGGGTCCCCTTTTGATCCCTCCGAGGACATCCCTGCCCCTCTGGGTGTGCCTGACTTCCAGGGAAGGGTTTTTGGTATCATCTCCCAAAGAGACAAACACAATAGTCCTGGGCATAATGAACCAGCAAACAGGGGACACGACGCTGTGGTCCCTACTTACACAGCACAGTACACTCCAAAATTGGGACAAATTCAAATTGGCACATGGCAGACTGACGACCTTACAGTCAACCAACCAGTCAAATTCACCCCAGTTGGACTCAATGACACTGAACATTTTAATCAATGGGTGGTCCCTAGGTATGCTGGTGCCCTAAACCTCAATACAAACCTTGCCCCTTCTGTTGCCCCAGTATTTCCAGGAGAGCGCCTGCTCTTCTTCAGATCATACATTCCCCTCAAGGGCGGTTATGGAAACCCAGCCATTGATTGCCTACTACCACAAGAGTGGGTGCAACACTTCTATCAGGAAGCAGCCCCTTCAATGAGTGAGGTGGCCCTCGTCAGATACATCAACCCGGACACTGGTCGGGCACTGTTTGAGGCCAAGCTCCACAGAGCTGGTTTCATGACAGTCTCGAGCAACACCAGTGCCCCGGTGGTTGTGCCTGCCAATGGATACTTCAGATTTGATTCTTGGGTGAACCAATTCTATTCTCTCGCCCCCATGGGAACTGGGAATGGGCGTAGAAGGGTTCAATAA